RESUMEN
Despite much progress, image processing remains a significant bottleneck for high-throughput analysis of microscopy data. One popular platform for single-cell time-lapse imaging is the mother machine, which enables long-term tracking of microbial cells under precisely controlled growth conditions. While several mother machine image analysis pipelines have been developed in the past several years, adoption by a non-expert audience remains a challenge. To fill this gap, we implemented our own software, MM3, as a plugin for the multidimensional image viewer napari. napari-MM3 is a complete and modular image analysis pipeline for mother machine data, which takes advantage of the high-level interactivity of napari. Here, we give an overview of napari-MM3 and test it against several well-designed and widely used image analysis pipelines, including BACMMAN and DeLTA. Researchers often analyze mother machine data with custom scripts using varied image analysis methods, but a quantitative comparison of the output of different pipelines has been lacking. To this end, we show that key single-cell physiological parameter correlations and distributions are robust to the choice of analysis method. However, we also find that small changes in thresholding parameters can systematically alter parameters extracted from single-cell imaging experiments. Moreover, we explicitly show that in deep learning-based segmentation, 'what you put is what you get' (WYPIWYG) - that is, pixel-level variation in training data for cell segmentation can propagate to the model output and bias spatial and temporal measurements. Finally, while the primary purpose of this work is to introduce the image analysis software that we have developed over the last decade in our lab, we also provide information for those who want to implement mother machine-based high-throughput imaging and analysis methods in their research.
Asunto(s)
Procesamiento de Imagen Asistido por Computador , Madres , Femenino , Humanos , Microscopía , Cultura , InvestigadoresRESUMEN
The integration of low-dimensional nanomaterials with microscale architectures in flexible pressure sensors has garnered significant interest due to their outstanding performance in healthcare monitoring. However, achieving high sensitivity across different magnitudes of external pressure remains a critical challenge. Herein, we present a high-performance flexible pressure sensor crafted from biomimetic hibiscus flower microstructures coated with silver nanowires. When compared with a flat electrode, these microstructures as electrodes display significantly enhanced sensitivity and an extended stimulus-response range. Furthermore, we utilized an ionic gel film as the dielectric layer, resulting in an enhancement of the overall performance of the flexible pressure sensor through an increase in interfacial capacitance. Consequently, the capacitive pressure sensor exhibits an extraordinary ultrahigh sensitivity of 48.57 [Kpa]-1 within the pressure range of 0-1 Kpa, 15.24 [Kpa]-1 within the pressure range of 1-30 Kpa, and 3.74 [Kpa]-1 within the pressure range of 30-120 Kpa, accompanied by a rapid response time (<58 ms). The exceptional performance of our flexible pressure sensor serves as a foundation for its numerous applications in healthcare monitoring. Notably, the flexible pressure sensor excels not only in detecting subtle physiological signals such as finger and wrist pulse signals, vocal cord vibrations, and breathing intensity but also demonstrates excellent performance in monitoring higher pressures, such as plantar pressure. We foresee that this flexible pressure sensor possesses significant potential in the field of wearable electronics.
RESUMEN
Tongue squamous cell carcinoma (TSCC) is a prevalent form of oral malignancy, with increasing incidence. Unfortunately, the 5-year survival rate for patients has not exceeded 50%. Studies have shown that sex-determining region Y box 9 (SOX9) correlates with malignancy and tumor stemness in a variety of tumors. To investigate the role of SOX9 in TSCC stemness, we analyzed its influence on various aspects of tumor biology, including cell proliferation, migration, invasion, sphere and clone formation, and drug resistance in TSCC. Our data suggest a close association between SOX9 expression and both the stemness phenotype and drug resistance in TSCC. Immunohistochemical experiments revealed a progressive increase of SOX9 expression in normal oral mucosa, paracancerous tissues, and tongue squamous carcinoma tissues. Furthermore, the expression of SOX9 was closely linked to the TNM stage, but not to lymph node metastasis or tumor diameter. SOX9 is a crucial gene in TSCC responsible for promoting the stemness function of cancer stem cells. Developing drugs that target SOX9 is extremely important in clinical settings.
Asunto(s)
Carcinoma de Células Escamosas , Neoplasias de la Boca , Neoplasias de la Lengua , Humanos , Carcinoma de Células Escamosas/patología , Neoplasias de la Lengua/metabolismo , Línea Celular Tumoral , Neoplasias de la Boca/genética , Lengua/metabolismo , Lengua/patología , Proliferación Celular , Regulación Neoplásica de la Expresión Génica , Movimiento Celular/genética , Factor de Transcripción SOX9/genética , Factor de Transcripción SOX9/metabolismoRESUMEN
INTRODUCTION: Chimeric antigen receptor (CAR)-T cells obtained long-term durability in about 30% to 40% of relapsed/refractory (r/r) B-cell non-Hodgkin lymphoma (B-NHL). Maintenance therapy after CAR-T is necessary, and PD1 inhibitor is one of the important maintenance therapy options. METHODS: A total of 173 r/r B-NHL patients treated with PD1 inhibitor maintenance following CD19/22 CAR-T therapy alone or combined with autologous hematopoietic stem cell transplantation (ASCT) from March 2019 to July 2022 were assessed for eligibility for two trials. There were 81 patients on PD1 inhibitor maintenance therapy. RESULTS: In the CD19/22 CAR-T therapy trial, the PD1 inhibitor maintenance group indicated superior objective response rate (ORR) (82.9% vs 60%; P = 0.04) and 2-year progression-free survival (PFS) (59.8% vs 21.3%; P = 0.001) than the non-maintenance group. The estimated 2-year overall survival (OS) was comparable in the two groups (60.1% vs 45.1%; P = 0.112). No difference was observed in the peak expansion levels of CD19 CAR-T and CD22 CAR-T between the two groups. The persistence time of CD19 and CD22 CAR-T in the PD1 inhibitor maintenance group was longer than that in the non-maintenance group. In the CD19/22 CAR-T therapy combined with ASCT trial, no significant differences in ORR (81.4% vs 84.8%; P = 0.67), 2-year PFS (72.3% vs 74.9%; P = 0.73), and 2-year OS (84.1% vs 80.7%; P = 0.79) were observed between non-maintenance and PD1 inhibitor maintenance therapy groups. The peak expansion levels and duration of CD19 and CD22 CAR-T were not statistically different between the two groups. During maintenance treatment with PD1 inhibitor, all adverse events were manageable. In the multivariable analyses, type and R3m were independent predictive factors influencing the OS of r/r B-NHL with PD1 inhibitor maintenance after CAR-T therapy. CONCLUSION: PD1 inhibitor maintenance following CD19/22 CAR-T therapy obtained superior response and survival in r/r B-NHL, but not in the trial of CD19/22 CAR-T cell therapy combined with ASCT.
RESUMEN
Black rot, caused by Xanthomonas campestris pv. campestris (Xcc) significantly affects the production of cabbage and other cruciferous vegetables. Plant antioxidant system plays an important role in pathogen invasion and is one of the main mechanisms underlying resistance to biological stress. Therefore, it is important to study the resistance mechanisms of the cabbage antioxidant system during the early stages of Xcc. In this study, 108 CFU/mL (OD600 = 0.1) Xcc race1 was inoculated on "zhonggan 11" cabbage using the spraying method. The effects of Xcc infection on the antioxidant system before and after Xcc inoculation (0, 1, 3, and 5 d) were studied by physiological indexes determination, transcriptome and metabolome analyses. We concluded that early Xcc infection can destroy the balance of the active oxygen metabolism system, increase the generation of free radicals, and decrease the scavenging ability, leading to membrane lipid peroxidation, resulting in the destruction of the biofilm system and metabolic disorders. In response to Xcc infection, cabbage clears a series of reactive oxygen species (ROS) produced during Xcc infection via various antioxidant pathways. The activities of antioxidant enzymes such as superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) increased after Xcc infection, and the ROS scavenging rate increased. The biosynthesis of non-obligate antioxidants, such as ascorbic acid (AsA) and glutathione (GSH), is also enhanced after Xcc infection. Moreover, the alkaloid and vitamin contents increased significantly after Xcc infection. We concluded that cabbage could resist Xcc invasion by maintaining the stability of the cell membrane system and improving the biosynthesis of antioxidant substances and enzymes after infection by Xcc. Our results provide theoretical basis and data support for subsequent research on the cruciferous vegetables resistance mechanism and breeding to Xcc.
Asunto(s)
Antioxidantes , Brassica , Enfermedades de las Plantas , Xanthomonas campestris , Xanthomonas campestris/fisiología , Xanthomonas campestris/patogenicidad , Brassica/microbiología , Brassica/metabolismo , Antioxidantes/metabolismo , Enfermedades de las Plantas/microbiología , Especies Reactivas de Oxígeno/metabolismoRESUMEN
Evidence suggests associations between COVID-19 patients or vaccines and glycometabolic dysfunction and an even higher risk of the occurrence of diabetes. Herein, we retrospectively analyzed pancreatic lesions in autopsy tissues from 67 SARS-CoV-2 infected non-human primates (NHPs) models and 121 vaccinated and infected NHPs from 2020 to 2023 and COVID-19 patients. Multi-label immunofluorescence revealed direct infection of both exocrine and endocrine pancreatic cells by the virus in NHPs and humans. Minor and limited phenotypic and histopathological changes were observed in adult models. Systemic proteomics and metabolomics results indicated metabolic disorders, mainly enriched in insulin resistance pathways, in infected adult NHPs, along with elevated fasting C-peptide and C-peptide/glucose ratio levels. Furthermore, in elder COVID-19 NHPs, SARS-CoV-2 infection causes loss of beta (ß) cells and lower expressed-insulin in situ characterized by islet amyloidosis and necrosis, activation of α-SMA and aggravated fibrosis consisting of lower collagen in serum, an increase of pancreatic inflammation and stress markers, ICAM-1 and G3BP1, along with more severe glycometabolic dysfunction. In contrast, vaccination maintained glucose homeostasis by activating insulin receptor α and insulin receptor ß. Overall, the cumulative risk of diabetes post-COVID-19 is closely tied to age, suggesting more attention should be paid to blood sugar management in elderly COVID-19 patients.
Asunto(s)
COVID-19 , Diabetes Mellitus , Adulto , Animales , Humanos , Anciano , SARS-CoV-2 , Receptor de Insulina , Péptido C , ADN Helicasas , Estudios Retrospectivos , Proteínas de Unión a Poli-ADP-Ribosa , ARN Helicasas , Proteínas con Motivos de Reconocimiento de ARN , GlucosaRESUMEN
CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P < 0.0500). In addition, sCD36 levels in type II individuals were significantly lower compared with positive controls (P = 0.0060). Nevertheless, we found the presence of sCD36 in a type I individual. RNA analysis showed CD36 RNA levels in platelets of type II individuals were significantly lower than the positive individuals (P = 0.0065). However, no significant difference was observed in monocytes (P = 0.7500). We identified the most prevalent mutation (c.1228_1239delATTGTGCCTATT) among Kunming donors. Besides, our results suggested RNA level alterations could potentially underlie type II deficiency. Furthermore, sCD36 may hold promise for assessing immune reaction risk in CD36-deficient individuals, but more studies should be conducted to validate this hypothesis.
Asunto(s)
Trastornos de las Plaquetas Sanguíneas , Antígenos CD36 , Humanos , Antígenos CD36/genética , Plaquetas , Bases de Datos Factuales , ARNRESUMEN
BACKGROUND: Breast cancer is the most common cancer in women, and in advanced stages, it often metastasizes to the brain. However, research on the biological mechanisms of breast cancer brain metastasis and potential therapeutic targets are limited. METHODS: Differential gene expression analysis (DEGs) for the datasets GSE43837 and GSE125989 from the GEO database was performed using online analysis tools such as GEO2R and Sangerbox. Further investigation related to SULF1 was conducted using online databases such as Kaplan-Meier Plotter and cBioPortal. Thus, expression levels, variations, associations with HER2, biological processes, and pathways involving SULF1 could be analyzed using UALCAN, cBioPortal, GEPIA2, and LinkedOmics databases. Moreover, the sensitivity of SULF1 to existing drugs was explored using drug databases such as RNAactDrug and CADSP. RESULTS: High expression of SULF1 was associated with poor prognosis in advanced breast cancer brain metastasis and was positively correlated with the expression of HER2. In the metastatic breast cancer population, SULF1 ranked top among the 16 DEGs with the highest mutation rate, reaching 11%, primarily due to amplification. KEGG and GSEA analyses revealed that the genes co-expressed with SULF1 were positively enriched in the 'ECM-receptor interaction' gene set and negatively enriched in the 'Ribosome' gene set. Currently, docetaxel and vinorelbine can act as treatment options if the expression of SULF1 is high. CONCLUSIONS: This study, through bioinformatics analysis, unveiled SULF1 as a potential target for treating breast cancer brain metastasis (BM).
RESUMEN
It is necessary to explore new targets for the treatment of colon adenocarcinoma (COAD) according to the tumor microenvironment. The expression levels of JAML and CXADR were analyzed by bioinformatics analysis and validation of clinical samples. JAML over-expression CD8+ T cell line was constructed, and the proliferation activity was detected by MTT. The production of inflammatory factors was detected by ELISA. The expression of immune checkpoint PD-1 and TIM-3 was detected by Western blot. The apoptosis level was detected by flow cytometry and apoptosis markers. The AOM/DSS mouse model of colorectal cancer was constructed. The expression levels of JAML, CXADR and PD-1 were detected by PCR and Western blot, and the proportion of CD8+ T cells and exhausted T cells were detected by flow cytometry. The expression levels of JAML and CXADR were significantly decreased in colon cancer tissues. Overexpression of JAML can promote the proliferation of T cells, secrete a variety of inflammatory factors. Overexpression of CXADR can reduce the proliferation of colorectal cancer cells, promote apoptosis, and down-regulate the migration and invasion ability of tumor cells. Both JAML agonists and PD-L1 inhibitors can effectively treat colorectal cancer, and the combined use of JAML agonists and PD-L1 inhibitors can enhance the effect. JAML can promote the proliferation and toxicity of CD8+ T cells and down-regulate the expression of immune checkpoints in colon cancer. CXADR can inhibit the proliferation of cancer cells and promote the apoptosis. JAML agonist can effectively treat colorectal cancer by regulating CD8+ T cells.
RESUMEN
The increasing depth of mine excavation presents greater challenges in mine ventilation and in managing cooling energy consumption. Therefore, there is an urgent need for comprehensive research on jet ventilation influenced by low-speed crossflows. This study investigated the impact of flow velocity ratios (R) and jet exit diameters (d) on flow-field distribution and flow characteristics through velocity measurements and smoke flow visualization experiments. The results of the study revealed two distinct types of air lakes formed by jet ventilation in crossflow (JVIC), with one being wall-attached and the other suspended. Notably, a significant secondary flow phenomenon was observed in the near-field near the upper wall. Additionally, the deflection angle (θj) of JVIC decreases as R and d/D increase, leading to the formation and movement of a semi-confined point (SP) and a confined point (CP) in the -x direction. Moreover, the wall confinement effect diminishes the jet's diffusion and deflection ability in the -z direction, leading to increased penetration in the x direction. Before the formation of the SP, the deflection section of the jet lengthens, followed by a rapid shortening upon its formation. Finally, the study further developed empirical equations for the jet axial trajectory and diffusion width.
RESUMEN
The harmless and high-value conversion of organic waste are the core problems to be solved by composting technology. This study introduced an innovative method of promoting targeted humification and nitrogen retention in composting by adding p-benzoquinone (PBQ), the composting without any additives was set as control group (CK). The results indicated that the addition of exogenous quinones led to a 30.1% increase in humic acid (HA) content during the heating and thermophilic phases of composting. Spectroscopic analyses confirmed that exogenous quinones form the core skeleton structure of amino-quinones in HA through composting biochemical reactions. This accelerated the transformation of quinones into recalcitrant HA in the early stages of composting, and reduced CO2 and NH3 by 8% and 78%, respectively. Redundancy analysis (RDA) revealed that the decrease in carbon and nitrogen losses primarily correlated with quinones enhancing HA formation and greater nitrogen incorporation into HA (P < 0.05). Furthermore, the compost treated with quinones demonstrated a decrease in phytotoxicity and earthworm mortality, alongside a significant increase in the relative abundance of actinobacteria, which are associated with the humification process. This research establishes and proposes that co-composting with quinones-containing waste is an effective approach for the sustainable recycling of hazardous solid waste.
RESUMEN
Cutaneous wound healing is a challenge in plastic and reconstructive surgery. In theory, cells undergoing mesenchymal transition will achieve re-epithelialization through mesenchymal-epithelial transition at the end of wound healing. But in fact, some pathological stimuli will inhibit this biological process and result in scar formation. If mesenchymal-epithelial transition can be activated at the corresponding stage, the ideal wound healing may be accomplished. Two in vivo skin defect mouse models and dermal-derived mesenchymal cells were used to evaluate the effect of lithium chloride in wound healing. The mesenchymal-epithelial transition was detected by immunohistochemistry staining. In vivo, differentially expressed genes were analysed by transcriptome analyses and the subsequent testing was carried out. We found that lithium chloride could promote murine cutaneous wound healing and facilitate mesenchymal-epithelial transition in vivo and in vitro. In lithium chloride group, scar area was smaller and the collagen fibres are also orderly arranged. The genes related to mesenchyme were downregulated and epithelial mark genes were activated after intervention. Moreover, transcriptome analyses suggested that this effect might be related to the inhibition of CXCL9 and IGF2, subsequent assays demonstrated it. Lithium chloride can promote mesenchymal-epithelial transition via downregulating CXCL9 and IGF2 in murine cutaneous wound healing, the expression of IGF2 is regulated by ß-catenin. It may be a potential promising therapeutic drug for alleviating postoperative scar and promoting re-epithelialization in future.
Asunto(s)
Cicatriz , Cloruro de Litio , Animales , Ratones , Cloruro de Litio/farmacología , Diferenciación Celular , Cicatrización de Heridas , PielRESUMEN
Ultra-high-performance concrete (UHPC), a new cement-based material that offers high mechanical strength and good durability, has been widely applied in construction and rehabilitation projects in recent years. An optimum bending system is achieved by positioning the UHPC layer at the bottom tensile zone of the composite beam and placing the normal-strength concrete (NC) layer at the upper compression zone, which is described as the UHPC-NC composite beam. The fatigue behavior of reinforced UHPC-NC composite beams was described in this study, with an emphasis on the effects of UHPC layer thickness and fatigue load level on the fatigue life of the beam, deformation of the interface between UHPC and NC layers, as well as the bending stiffness of the beam. A total of 9 reinforced UHPC-NC composite beams were tested under cyclic loading. The test variables include UHPC layer thicknesses (zero, 200, and 360 mm), reinforcement ratios (1.184% and 1.786%), and the upper load levels (0.39~0.65). The results showed that good bonding had been achieved without delamination between UHPC and NC layers prior to the final fatigue failure of the beam, and the bending stiffness of the composite beam experienced a three-stage reduction under cyclic loading. Furthermore, an equation was proposed to predict the stiffness reduction coefficient of UHPC-NC composite beams under cyclic loading.
RESUMEN
IMPORTANCE: The first meta-analysis focused only on gonadotropin-releasing hormone (GnRH) antagonists, which helped determine the effect of delay trigger on pregnancy outcomes. OBJECTIVE: To evaluate the impact of delay trigger compared with standard trigger in normal responders undergoing GnRH antagonist protocol in improving pregnancy outcomes. METHODS: Studies published before April 2023 in PubMed, EMBASE, Cochrane Library, Web of Science, CNKI, Wanfang, VIP and CBM databases were searched. Randomized controlled trials (RCTs) and cohort studies conducted in normal responders reporting the efficacy of delay trigger using GnRH antagonist protocol were included. Data were combined to calculate mean differences (MD) for continuous variables and odd ratios (OR) for categorical variables with their corresponding 95% confidence intervals (CIs). Heterogeneity was assessed using Cochran's Q test. RESULTS: Endpoints, including clinical pregnancy rate (CPR), live birth rate (LBR), the number of oocyte retrievals and embryos, and fertilization rate, were analyzed. Six (6) clinical studies (4 RCTs and 2 cohort studies) with 1,360 subjects were included. The pooled results showed that the number of oocyte retrievals (MD: 1.20, 95% CI: 1.10, 1.30, p < 0.01), fertilization rate (MD: 0.64, 95% CI: 0.29, 0.99, p < 0.01) and days of stimulation (MD: 0.95; 95% CI: 0.54, 1.37; p < 0.01) in the delay trigger group was significantly higher than that in the standard trigger group. However, there was no significant difference in the number of embryos (MD: 0.19, 95% CI: -0.29, 0.67, p = 0.44), CPR (OR: 1.12; 95% CI: 0.72, 1.75; p = 0.062), and LBR (OR: 1.23; 95% CI: 0.90, 1.66; p = 0.19) between the two trigger groups. CONCLUSION: Delaying trigger time in GnRH antagonist protocol increased the number of oocytes retrieved but not the number of embryos. Furthermore, delay trigger shot was not associated with a clinical benefit towards CPR and LBR in women who underwent fresh embryo transfer cycles. TRIAL REGISTRATION: The International Prospective Register of Systematic Reviews (PROSPERO), registration number: CRD42023413217.
Asunto(s)
Tasa de Natalidad , Transferencia de Embrión , Femenino , Embarazo , Humanos , Revisiones Sistemáticas como Asunto , Bases de Datos Factuales , Antagonistas de Hormonas/farmacología , Antagonistas de Hormonas/uso terapéutico , Hormona Liberadora de Gonadotropina , Metaanálisis como AsuntoRESUMEN
Designing proteins with tailored structures and functions is a long-standing goal in bioengineering. Recently, deep learning advances have enabled protein structure prediction at near-experimental accuracy, which has catalyzed progress in protein design as well. We review recent studies that use structure-prediction neural networks to design proteins, via approaches such as activation maximization, inpainting, or denoising diffusion. These methods have led to major improvements over previous methods in wet-lab success rates for designing protein binders, metalloproteins, enzymes, and oligomeric assemblies. These results show that structure-prediction models are a powerful foundation for developing protein-design tools and suggest that continued improvement of their accuracy and generality will be key to unlocking the full potential of protein design.
RESUMEN
CircLRIG1, a newly discovered circRNA, has yet to have its potential function and biological processes reported. This study explored the role of circLRIG1 in the development and progression of bladder carcinoma and its potential molecular mechanisms. Techniques such as qRT-PCR, Western blot, various cellular assays, and in vivo models were used to investigate mRNA and protein levels, cell behavior, molecular interactions, and tumor growth. The results showed that both circLRIG1 and LRIG1 were significantly reduced in bladder carcinoma tissues and cell lines. Low circLRIG1 expression was associated with poor patient prognosis. Overexpressing circLRIG1 inhibited bladder carcinoma cell growth, migration, and invasion, promoted apoptosis, and decreased tumor growth and metastasis in vivo. Importantly, circLRIG1 was found to sponge miR-214-3p, enhancing LRIG1 expression, and its overexpression also modulated protein levels of E-cadherin, N-cadherin, Vimentin, and LRIG1. Similar effects were observed with LRIG1 overexpression. Notably, a positive correlation was found between circLRIG1 and LRIG1 expression in bladder carcinoma tissues. Additionally, the tumor-suppressing effect of circLRIG1 was reversed by overexpressing miR-214-3p or silencing LRIG1. The study concludes that circLRIG1 suppresses bladder carcinoma progression by enhancing LRIG1 expression via sponging miR-214-3p, providing a potential strategy for early diagnosis and treatment of bladder carcinoma.
Asunto(s)
Carcinoma , MicroARNs , Neoplasias de la Vejiga Urinaria , Humanos , MicroARNs/genética , MicroARNs/metabolismo , Vejiga Urinaria/metabolismo , Vejiga Urinaria/patología , Línea Celular Tumoral , Proliferación Celular/genética , Neoplasias de la Vejiga Urinaria/genética , Neoplasias de la Vejiga Urinaria/metabolismo , Neoplasias de la Vejiga Urinaria/patología , Carcinoma/genética , Movimiento Celular , Regulación Neoplásica de la Expresión Génica , Glicoproteínas de Membrana/metabolismoRESUMEN
Previous research has found that prolonged eye-based attention can bias ocular dominance. If one eye long-termly views a regular movie meanwhile the opposite eye views a backward movie of the same episode, perceptual ocular dominance will shift towards the eye previously viewing the backward movie. Yet it remains unclear whether the role of eye-based attention in this phenomenon is causal or not. To address this issue, the present study relied on both the functional magnetic resonance imaging (fMRI) and transcranial magnetic stimulation (TMS) techniques. We found robust activation of the frontal eye field (FEF) and intraparietal sulcus (IPS) when participants were watching the dichoptic movie while focusing their attention on the regular movie. Interestingly, we found a robust effect of attention-induced ocular dominance shift when the cortical function of vertex or IPS was transiently inhibited by continuous theta burst stimulation (cTBS), yet the effect was significantly attenuated to a negligible extent when cTBS was delivered to FEF. A control experiment verified that the attenuation of ocular dominance shift after inhibitory stimulation of FEF was not due to any impact of the cTBS on the binocular rivalry measurement of ocular dominance. These findings suggest that the fronto-parietal attentional network is involved in controlling eye-based attention in the 'dichoptic-backward-movie' adaptation paradigm, and in this network, FEF plays a crucial causal role in generating the attention-induced ocular dominance shift.
Asunto(s)
Predominio Ocular , Estimulación Magnética Transcraneal , Humanos , Estimulación Magnética Transcraneal/métodos , Atención/fisiología , Lóbulo Frontal/fisiología , Lóbulo Parietal/fisiología , Estimulación Luminosa/métodosRESUMEN
Thyroid cancer can be classified into three different types based on the degree of differentiation: well-differentiated, poorly differentiated, and anaplastic thyroid carcinoma. Well-differentiated thyroid cancer refers to cancer cells that closely resemble normal thyroid cells, while poorly differentiated and anaplastic thyroid carcinoma are characterized by cells that have lost their resemblance to normal thyroid cells. Advanced thyroid carcinoma, regardless of its degree of differentiation, is known to have a higher likelihood of disease progression and is generally associated with a poor prognosis. However, the process through which well-differentiated thyroid carcinoma transforms into anaplastic thyroid carcinoma, also known as "dedifferentiation", has been a subject of intensive research. In recent years, there have been significant breakthroughs in the treatment of refractory advanced thyroid cancer. Clinical studies have been conducted to evaluate the efficacy and safety of molecular targeted drugs and immune checkpoint inhibitors in the treatment of dedifferentiated thyroid cancer. These drugs work by targeting specific molecules or proteins in cancer cells to inhibit their growth or by enhancing the body's immune response against the cancer cells. This article aims to explore some of the possible mechanisms behind the dedifferentiation process in well-differentiated thyroid carcinoma. It also discusses the clinical effects of molecular targeted drugs and immune checkpoint inhibitors in thyroid cancer patients with different degrees of differentiation. Furthermore, it offers insights into the future trends in the treatment of advanced thyroid cancer, highlighting the potential for improved outcomes and better patient care.
RESUMEN
Deep-learning methods have revolutionized protein structure prediction and design but are presently limited to protein-only systems. We describe RoseTTAFold All-Atom (RFAA), which combines a residue-based representation of amino acids and DNA bases with an atomic representation of all other groups to model assemblies that contain proteins, nucleic acids, small molecules, metals, and covalent modifications, given their sequences and chemical structures. By fine-tuning on denoising tasks, we developed RFdiffusion All-Atom (RFdiffusionAA), which builds protein structures around small molecules. Starting from random distributions of amino acid residues surrounding target small molecules, we designed and experimentally validated, through crystallography and binding measurements, proteins that bind the cardiac disease therapeutic digoxigenin, the enzymatic cofactor heme, and the light-harvesting molecule bilin.
Asunto(s)
Aminoácidos , Proteínas , Proteínas/química , ADN/química , CristalografíaRESUMEN
PURPOSE: NCI-MATCH assigned patients with advanced cancer and progression on prior treatment, based on genomic alterations in pretreatment tumor tissue. Arm J (EAY131-J) evaluated the combination of trastuzumab/pertuzumab (HP) across HER2-amplified tumors. PATIENTS AND METHODS: Eligible patients had high levels of HER2 amplification [copy number (CN) ≥7] detected by central next-generation sequencing (NGS) or through NCI-designated laboratories. Patients with breast/gastroesophageal adenocarcinoma and those who received prior HER2-directed therapy were excluded. Enrollment of patients with colorectal cancer was capped at 4 based on emerging data. Patients received HP IV Q3 weeks until progression or unacceptable toxicity. Primary endpoint was objective response rate (ORR); secondary endpoints included progression-free survival (PFS) and overall survival (OS). RESULTS: Thirty-five patients were enrolled, with 25 included in the primary efficacy analysis (CN ≥7 confirmed by a central lab, median CN = 28). Median age was 66 (range, 31-80), and half of all patients had ≥3 prior therapies (range, 1-11). The confirmed ORR was 12% [3/25 partial responses (colorectal, cholangiocarcinoma, urothelial cancers), 90% confidence interval (CI) 3.4%-28.2%]. There was one additional partial response (urothelial cancer) in a patient with an unconfirmed ERBB2 copy number. Median PFS was 3.3 months (90% CI 2.0-4.1), and median OS 9.4 months (90% CI 5.0-18.9). Treatment-emergent adverse events were consistent with prior studies. There was no association between HER2 CN and response. CONCLUSIONS: HP was active in a selection of HER2-amplified tumors (non-breast/gastroesophageal) but did not meet the predefined efficacy benchmark. Additional strategies targeting HER2 and potential resistance pathways are warranted, especially in rare tumors.